Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04651

HP ID(1) HP04651
Gene ID(2) 29108
Gene Symbol finder PYCARD
Protein Name PYD and CARD domain containing
RefSeq NM_013258.3
Length of RefSeq (bp) 936
Chromosome 16p12-p11.2
Reference DDBJ accession
UniGene Hs.499094

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa75F02 pKA1U5 GCTCGCAGGCCAGCTGGAGGGCGCGATCCTGGCGTCCCCCGACGGCCTGGGGCCCCAATC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl