Prev. |  KEGG KO K12799 > 

RIKEN DNA Bank Human Resource - PYCARD

Gene ID NCBI Gene 29108 |  KEGG hsa:29108
Gene Symbol PYCARD
Protein Name PYD and CARD domain containing
Synonyms ASC|CARD5|TMS|TMS-1|TMS1
Ortholog resources KEGG ortholog (KEGG orthology K12799) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005958 IRAK014O22 pCMV-SPORT6 BC013569 NM_145183 Partial/var
HGY085753 IRAL014G09 pOTB7 BC004470 NM_145183 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR030122 ARa75F02 pKA1U5 NM_013258.3  
GCTCGCAGGCCAGCTGGAGGGCGCGATCCTGGCGTCCCCCGACGGCCTGGGGCCCCAATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl