Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04644

HP ID(1) HP04644
Gene ID(2) 51247
Gene Symbol finder PAIP2
Protein Name poly(A) binding protein interacting protein 2
RefSeq NM_016480.3
Length of RefSeq (bp) 1500
Chromosome 5q31.2
Reference DDBJ accession
UniGene Hs.396644

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb35F05 pGCAP1 GACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTTCGAGCGGGGGAGCGGCGCTGCCTG
RBd06D04 pGCAP10 GGTTTTGTTTGGACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTCGAGCGGGGGAGCG
RBd26F08 pGCAP10 CGGCCGGCCGATGGGACTGGAGAAGGGAGGCGGCGGGCGAATCGCACGTCGAGCGGGGGA
RBd43C08 pGCAP10 GGGACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCT
RBd83C11 pGCAP10 GGGACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCT
RBdS070J19 pGCAP10 GGGGCGAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCTGTGGAGATCCGCGGAGGCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl