Prev. | 

RIKEN DNA Bank Human Resource - PAIP2

Gene ID NCBI Gene 51247 |  KEGG hsa:51247
Gene Symbol PAIP2
Protein Name poly(A) binding protein interacting protein 2
Synonyms PAIP-2|PAIP2A
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082441 IRAL006B17 pOTB7 BC001716 NM_016480 Full
HGY100732 IRAL051N20 pDNR-LIB BC062718 NM_016480 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR334125 RBb35F05 pGCAP1 NM_016480.3  
GACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTTCGAGCGGGGGAGCGGCGCTGCCTG
HKR362476 RBd06D04 pGCAP10 NM_016480.3  
GGTTTTGTTTGGACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTCGAGCGGGGGAGCG
HKR370528 RBd26F08 pGCAP10 NM_016480.3  
CGGCCGGCCGATGGGACTGGAGAAGGGAGGCGGCGGGCGAATCGCACGTCGAGCGGGGGA
HKR377256 RBd43C08 pGCAP10 NM_016480.3  
GGGACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCT
HKR393259 RBd83C11 pGCAP10 NM_016480.3  
GGGACTGGAGAAGGGAGGCGGCGGGCGAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCT
HKR428235 RBdS070J19 pGCAP10 NM_016480.3  
GGGGCGAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCTGTGGAGATCCGCGGAGGCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl