Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04641

HP ID(1) HP04641
Gene ID(2) 57103
Gene Symbol finder C12orf5
Protein Name chromosome 12 open reading frame 5
RefSeq NM_020375.2
Length of RefSeq (bp) 8237
Chromosome 12p13.3
Reference DDBJ accession
UniGene Hs.504545

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa72F08 pKA1U5 GGGAAGTGGTGTGGGGGAGGTAGCCCGCAGTGCAGGGGCAGCGCGGCGCGGGGCCACCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl