RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - TIGAR

Gene ID	NCBI Gene 57103 \| KEGG hsa:57103
Gene Symbol	TIGAR
Protein Name	TP53 induced glycolysis regulatory phosphatase
Synonyms	C12orf5\|FR2BP

Link

Ortholog resource in our bank

TIGAR

External database

human TIGAR

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB07414	pGL4-phC12orf5(TIGAR)	Promoter collection, Human C12orf5 promoter

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY091795	IRAL029I03	pOTB7	BC012340	NM_020375	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR028928	ARa72F08	pKA1U5	NM_020375.2
HKR028928	GGGAAGTGGTGTGGGGGAGGTAGCCCGCAGTGCAGGGGCAGCGCGGCGCGGGGCCACCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.25

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl