Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04633

HP ID(1) HP04633
Gene ID(2) 51227
Gene Symbol finder PIGP
Protein Name phosphatidylinositol glycan anchor biosynthesis, class P
RefSeq NM_153681.2
Length of RefSeq (bp) 911
Chromosome 21q22.2
Reference DDBJ accession
UniGene Hs.656565

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi20G03 pGCAP10 GGCGCCTAGGCCTTTCCCTCAGGTTTTCCTCTTCCCCACTGCGGCTCCCCAGTCGGCGCT
ARi44G08 pGCAP10 GCCCAGTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCTAAAGCCCCAGGAAAAA
ARiS013B24 pGCAP10 GCCCAGTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCTAAAGCCCCAGGAAAAA
RBb36C02 pGCAP1 GTCCCCACAGGCGGGCTCCCCAGNTCGGCGCCTTGCGCGGAGAAACTCAGCGCTGAGATT
RBb49E04 pGCAP1 GTCCCCACTGCGGCTCCCCAGNTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl