Prev. |  KEGG KO K03861 > 

RIKEN DNA Bank Human Resource - PIGP

Gene ID NCBI Gene 51227 |  KEGG hsa:51227
Gene Symbol PIGP
Protein Name phosphatidylinositol glycan anchor biosynthesis class P
Synonyms DCRC|DCRC-S|DSCR5|DSRC|EIEE55|PIG-P
Ortholog resource in our bank

  PIGP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086429 IRAL016B05 pDNR-LIB BC005180 NM_153682 Full
HGY087887 IRAL019L23 pDNR-LIB BC011007 NM_153682 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036553 W01A091G09 pENTR-TOPO IRAL016B05 BC005180 NM_153682  
HGE036555 W01A091G11 pENTR-TOPO IRAL016B05 BC005180 NM_153682  
HGE036559 W01A091G15 pENTR-TOPO IRAL016B05 BC005180 NM_153682  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168147 ARi20G03 pGCAP10 NM_153681.2  
GGCGCCTAGGCCTTTCCCTCAGGTTTTCCTCTTCCCCACTGCGGCTCCCCAGTCGGCGCT
HKR177752 ARi44G08 pGCAP10 NM_153681.2  
GCCCAGTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCTAAAGCCCCAGGAAAAA
HKR205248 ARiS013B24 pGCAP10 NM_153681.2  
GCCCAGTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCTAAAGCCCCAGGAAAAA
HKR334450 RBb36C02 pGCAP1 NM_153681.2  
GTCCCCACAGGCGGGCTCCCCAGNTCGGCGCCTTGCGCGGAGAAACTCAGCGCTGAGATT
HKR339700 RBb49E04 pGCAP1 NM_153681.2  
GTCCCCACTGCGGCTCCCCAGNTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl