Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04601

HP ID(1) HP04601
Gene ID(2) 55299
Gene Symbol finder BXDC2
Protein Name brix domain containing 2
RefSeq NM_018321.3
Length of RefSeq (bp) 1303
Chromosome 5p13.2
Reference DDBJ accession
UniGene Hs.718510

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb58A07 pGCAP1 GGGAGGCCAAGTAGCGCGGGCGGCGAGGCAAGATGGCGGCNACCAAGAGGAAACGGCGTG
RBd75C11 pGCAP10 GGCGGGCGGCGAGGCAAGATGGCGGCAACCAAGAGGAAACGGCGTGGAGGCTTTGCAGTT
RBd85C03 pGCAP10 GAAGAGCGCGGGCGGCGAGGCAAGATGGCGGCAACCAAGAGGAAACGGCGTGGAGGCTTT
RBd97C03 pGCAP10 GGAGGCAAGATGGCGGCAACCAAGAGGAAACGGCGTGGAGGCTTTGCAGTTCAGGCGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl