Prev. |  KEGG KO K14820 > 

RIKEN DNA Bank Human Resource - BRIX1

Gene ID NCBI Gene 55299 |  KEGG hsa:55299
Gene Symbol BRIX1
Protein Name biogenesis of ribosomes BRX1
Synonyms BRIX|BXDC2
Ortholog resources KEGG ortholog (KEGG orthology K14820) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001686 IRAK004D14 pCMV-SPORT6 BC001546 NM_018321
HGX027365 IRAK068G21 pCMV-SPORT6 BC036741 NM_018321 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010140 W01A025F20 pENTR-TOPO IRAK068G21 BC036741 NM_018321  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR343207 RBb58A07 pGCAP1 NM_018321.3  
GGGAGGCCAAGTAGCGCGGGCGGCGAGGCAAGATGGCGGCNACCAAGAGGAAACGGCGTG
HKR390059 RBd75C11 pGCAP10 NM_018321.3  
GGCGGGCGGCGAGGCAAGATGGCGGCAACCAAGAGGAAACGGCGTGGAGGCTTTGCAGTT
HKR394051 RBd85C03 pGCAP10 NM_018321.3  
GAAGAGCGCGGGCGGCGAGGCAAGATGGCGGCAACCAAGAGGAAACGGCGTGGAGGCTTT
HKR398851 RBd97C03 pGCAP10 NM_018321.3  
GGAGGCAAGATGGCGGCAACCAAGAGGAAACGGCGTGGAGGCTTTGCAGTTCAGGCGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl