Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04595

HP ID(1) HP04595
Gene ID(2) 118424
Gene Symbol finder UBE2J2
Protein Name ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)
RefSeq NM_194315.1
Length of RefSeq (bp) 2315
Chromosome 1p36.33
Reference DDBJ accession
UniGene Hs.191987

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb34D05 pGCAP1 GGAGGCTGAGGCGGCGGCGGCGGCGCTGCGGCGGGTTCGGTGGGCCCAATCCCGGGGCGG
RBb49A09 pGCAP1 TGCCCGCGAGCGGCCATCTTGGAGGCTGAGGCGGCGGCGGCGGCNCTGCGGCGGGTTCGG
RBd27F12 pGCAP10 GGAGCGGCCATCTTGGAGGCTGAGGCGGCGGCGGCGGCGCTGCGGCGGGTTCGGTGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl