Prev. |  KEGG KO K04554 > 

RIKEN DNA Bank Human Resource - UBE2J2

Gene ID NCBI Gene 118424 |  KEGG hsa:118424
Gene Symbol UBE2J2
Protein Name ubiquitin conjugating enzyme E2 J2
Synonyms NCUBE-2|NCUBE2|PRO2121
Featured content Parkinson disease - human
Ortholog resource in our bank

  UBE2J2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093342 IRAL033F22 pOTB7 BC027728 NM_194458
HGY098893 IRAL047D21 pOTB7 BC052579 NM_194458

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR333677 RBb34D05 pGCAP1 NM_194315.1  
GGAGGCTGAGGCGGCGGCGGCGGCGCTGCGGCGGGTTCGGTGGGCCCAATCCCGGGGCGG
HKR339609 RBb49A09 pGCAP1 NM_194315.1  
TGCCCGCGAGCGGCCATCTTGGAGGCTGAGGCGGCGGCGGCGGCNCTGCGGCGGGTTCGG
HKR370932 RBd27F12 pGCAP10 NM_194315.1  
GGAGCGGCCATCTTGGAGGCTGAGGCGGCGGCGGCGGCGCTGCGGCGGGTTCGGTGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl