Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04593

HP ID(1) HP04593
Gene ID(2) 84334
Gene Symbol finder C14orf153
Protein Name chromosome 14 open reading frame 153
RefSeq NM_032374.3
Length of RefSeq (bp) 1244
Chromosome 14q32.33
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe57E08 pKA1U5 GGGGGCCATGGNTGGTCTTGCGGGCGGGGAAGAAGANCTTTCTCCCCGCTCTCTGCCGCG
ARiS013O15 pGCAP10 GGTCGCANTGCTGCCNNGCGCCGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCG
RBb56A12 pGCAP1 GGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCGGGCGGGGAAGAAGACCTTTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl