Prev. | 

RIKEN DNA Bank Human Resource - COA8

Gene ID NCBI Gene 84334 |  KEGG hsa:84334
Gene Symbol COA8
Protein Name cytochrome c oxidase assembly factor 8
Synonyms APOP|APOP1|APOPT1|C14orf153
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081266 IRAL003C18 pOTB7 BC007412 NM_032374

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100009 M01C050A09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100057 M01C050C09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100105 M01C050E09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100153 M01C050G09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100201 M01C050I09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100249 M01C050K09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100297 M01C050M09 pDONR221 MGC14-E05 BC007412 ENST00000247618  
HGE100345 M01C050O09 pDONR221 MGC14-E05 BC007412 ENST00000247618  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062904 ARe57E08 pKA1U5 NM_032374.3  
GGGGGCCATGGNTGGTCTTGCGGGCGGGGAAGAAGANCTTTCTCCCCGCTCTCTGCCGCG
HKR205551 ARiS013O15 pGCAP10 NM_032374.3  
GGTCGCANTGCTGCCNNGCGCCGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCG
HKR342412 RBb56A12 pGCAP1 NM_032374.3  
GGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCGGGCGGGGAAGAAGACCTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl