Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04588

HP ID(1) HP04588
Gene ID(2) 5283
Gene Symbol finder PIGH
Protein Name phosphatidylinositol glycan anchor biosynthesis, class H
RefSeq NM_004569.3
Length of RefSeq (bp) 1439
Chromosome 14q11-q24
Reference DDBJ accession
UniGene Hs.553497

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb38D02 pGCAP1 GTGGAGCGGGCGAGACGACCAGGGCCGGCGTAGCGCAGTGCAGCGCCGCGCGGTGCGGGC
RBd66F05 pGCAP10 GAGAGANGACCAGGGCCGGCGAGCGCAGTGCAGCGCCGCGCGGTGCGGGCGGCCGAGTGG
RBd92F02 pGCAP10 GACGACCAGGGCCGGCGAGCGCAGTGCAGCGCCGTGCGGTGCGGGCGGCCGAGTGGGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl