Prev. |  KEGG KO K03858 > 

RIKEN DNA Bank Human Resource - PIGH

Gene ID NCBI Gene 5283 |  KEGG hsa:5283
Gene Symbol PIGH
Protein Name phosphatidylinositol glycan anchor biosynthesis class H
Synonyms GPI-H
Ortholog resource in our bank

  PIGH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085782 IRAL014H14 pOTB7 BC004100 NM_004569 Full
HGY103371 IRAL058H03 pOTB7 BC071849 NM_004569 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017535 W01A043N23 pENTR-TOPO IRAL014H14 BC004100 NM_004569  
HGE017565 W01A043P05 pENTR-TOPO IRAL014H14 BC004100 NM_004569  
HGE017567 W01A043P07 pENTR-TOPO IRAL014H14 BC004100 NM_004569  
HGE017569 W01A043P09 pENTR-TOPO IRAL014H14 BC004100 NM_004569  
HGE017571 W01A043P11 pENTR-TOPO IRAL014H14 BC004100 NM_004569  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR335274 RBb38D02 pGCAP1 NM_004569.3  
GTGGAGCGGGCGAGACGACCAGGGCCGGCGTAGCGCAGTGCAGCGCCGCGCGGTGCGGGC
HKR386525 RBd66F05 pGCAP10 NM_004569.3  
GAGAGANGACCAGGGCCGGCGAGCGCAGTGCAGCGCCGCGCGGTGCGGGCGGCCGAGTGG
HKR396922 RBd92F02 pGCAP10 NM_004569.3  
GACGACCAGGGCCGGCGAGCGCAGTGCAGCGCCGTGCGGTGCGGGCGGCCGAGTGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl