Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04579

HP ID(1) HP04579
Gene ID(2) 283871
Gene Symbol finder PGP
Protein Name phosphoglycolate phosphatase
RefSeq NM_001042371.2
Length of RefSeq (bp) 3136
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.442634

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb71A01 pGCAP1 GGGCGGGCGGCGATGGCGGCGGCGGAGGCCGGTGGCGACGACGCCCGCTGCGTGCGGCTG
RBd42F02 pGCAP10 GGGGCGGCGGCGGCCGGCGGGCGGCGATGGCGGCGGCGGAGGCCGGTGGCGACGACGCCC
RBd48G06 pGCAP10 GGGGCGGCGGCGGCCGGCGGGCGGCGATGGCGGCGGCGGAGGCCGGTGGCGACGACGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl