Prev. |  KEGG KO K19269 > 

RIKEN DNA Bank Human Resource - PGP

Gene ID NCBI Gene 283871 |  KEGG hsa:283871
Gene Symbol PGP
Protein Name phosphoglycolate phosphatase
Synonyms AUM|G3PP|PGPase
Ortholog resources KEGG ortholog (KEGG orthology K19269) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084685 IRAL011L21 pOTB7 BC002330
HGY096438 IRAL041B14 pDNR-LIB BC035985

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348401 RBb71A01 pGCAP1 NM_001042371.2  
GGGCGGGCGGCGATGGCGGCGGCGGAGGCCGGTGGCGACGACGCCCGCTGCGTGCGGCTG
HKR376922 RBd42F02 pGCAP10 NM_001042371.2  
GGGGCGGCGGCGGCCGGCGGGCGGCGATGGCGGCGGCGGAGGCCGGTGGCGACGACGCCC
HKR379350 RBd48G06 pGCAP10 NM_001042371.2  
GGGGCGGCGGCGGCCGGCGGGCGGCGATGGCGGCGGCGGAGGCCGGTGGCGACGACGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl