Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04569

HP ID(1) HP04569
Gene ID(2) 83638
Gene Symbol finder C11orf68
Protein Name chromosome 11 open reading frame 68
RefSeq NM_031450.3
Length of RefSeq (bp) 1568
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.433573

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46H09 pKA1U5 GGAGGTGGCGCGGCGCTAAGATGGCGGCGGCGGCGGCGGCGGCCGTGGCGGGGGTGGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl