Prev. | 

RIKEN DNA Bank Human Resource - C11orf68

Gene ID NCBI Gene 83638 |  KEGG hsa:83638
Gene Symbol C11orf68
Protein Name chromosome 11 open reading frame 68
Synonyms BLES03|P5326
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007660 IRAK019C12 pCMV-SPORT6 BC010512 NM_031450 Full
HGX010712 IRAK026M24 pCMV-SPORT6 BC013185 NM_031450
HGY085244 IRAL013B20 pOTB7 BC004414 NM_031450 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058577 ARe46H09 pKA1U5 NM_031450.3  
GGAGGTGGCGCGGCGCTAAGATGGCGGCGGCGGCGGCGGCGGCCGTGGCGGGGGTGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl