Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04568

HP ID(1) HP04568
Gene ID(2) 129685
Gene Symbol finder TAF8
Protein Name TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
RefSeq NM_138572.2
Length of RefSeq (bp) 4323
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.520122

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa55G03 pKA1U5 GGCACACTACGCCAGAACAAGATGGCCGACGCGGCGGCCACAGCTGGGGCCGGTGGCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl