Prev. |  KEGG KO K14649 > 

RIKEN DNA Bank Human Resource - TAF8

Gene ID NCBI Gene 129685 |  KEGG hsa:129685
Gene Symbol TAF8
Protein Name TATA-box binding protein associated factor 8
Synonyms II|TAF|TAF(II)43|TAFII-43|TAFII43|TBN
Ortholog resource in our bank

  TAF8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR022147 ARa55G03 pKA1U5 NM_138572.2  
GGCACACTACGCCAGAACAAGATGGCCGACGCGGCGGCCACAGCTGGGGCCGGTGGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl