Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04562

HP ID(1) HP04562
Gene ID(2) 7307
Gene Symbol finder U2AF1
Protein Name U2 small nuclear RNA auxiliary factor 1
RefSeq NM_006758.2
Length of RefSeq (bp) 971
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.365116

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe33C12 pKA1U5 GGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGGCAC
ARe87C09 pKA1U5 GGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCG
ARi03B02 pGCAP10 GGACGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCG
ARi28G09 pGCAP10 GGACGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCG
ARiS198O14 pGCAP10
RBb16F10 pKA1U5 GGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGA
RBb50B02 pGCAP1 GGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGC
RBb54G04 pGCAP1 GGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTATGGGCCCA
RBb58A05 pGCAP1 GGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGG
RBd05G11 pGCAP10 GGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAAT
RBd23C07 pGCAP10 GAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTT
RBd34A05 pGCAP10 GGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGT
RBd39H07 pGCAP10 GGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGG
RBd40D01 pGCAP10 GAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTT
RBd54H03 pGCAP10 GAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCNTCTTCGGCACCGAGAA
RBd65G06 pGCAP10 GGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGA
RBd71F11 pGCAP10 GAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTT
RBdS081P23 pGCAP10 GCTCCGGAGCCGCCGCCTCGTGGGCCGCGCGGCGGAAAACTGGAGCGGGCAGAATGAATG
RBdS110P17 pGCAP10 GGTCTCCCGAGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCG
RBdS187F14 pGCAP10 TGGACGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl