Prev. |  KEGG KO K12836 > 

RIKEN DNA Bank Human Resource - U2AF1

Gene ID NCBI Gene 7307 |  KEGG hsa:7307
Gene Symbol U2AF1
Protein Name U2 small nuclear RNA auxiliary factor 1
Synonyms FP793|RN|RNU2AF1|U2AF35|U2AFBP
Ortholog resources KEGG ortholog (KEGG orthology K12836) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083217 IRAL008A17 pOTB7 BC001177 NM_006758 Full
HGY083892 IRAL009M04 pOTB7 BC001923 NM_006758 Full
HGY088538 IRAL021F18 pDNR-LIB BC005915 NM_001025204 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097614 M01C044A14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097662 M01C044C14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097710 M01C044E14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097758 M01C044G14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097806 M01C044I14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097854 M01C044K14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097902 M01C044M14 pDONR221 MGC11-F07 BC001177 NM_006758  
HGE097950 M01C044O14 pDONR221 MGC11-F07 BC001177 NM_006758  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001063 W01A002K23 pENTR-TOPO IRAL008A17 BC001177 NM_006758  
HGE001049 W01A002K09 pENTR-TOPO IRAL009M04 BC001923 NM_006758  
HGE001051 W01A002K11 pENTR-TOPO IRAL009M04 BC001923 NM_006758  
HGE001053 W01A002K13 pENTR-TOPO IRAL009M04 BC001923 NM_006758  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053260 ARe33C12 pKA1U5 NM_006758.2  
GGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGGCAC
HKR074857 ARe87C09 pKA1U5 NM_006758.2  
GGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCG
HKR161226 ARi03B02 pGCAP10 NM_006758.2  
GGACGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCG
HKR171353 ARi28G09 pGCAP10 NM_006758.2  
GGACGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCG
HKR279550 ARiS198O14 pGCAP10 NM_006758.2  
HKR326530 RBb16F10 pKA1U5 NM_006758.2  
GGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGA
HKR340026 RBb50B02 pGCAP1 NM_006758.2  
GGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGC
HKR341748 RBb54G04 pGCAP1 NM_006758.2  
GGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTATGGGCCCA
HKR343205 RBb58A05 pGCAP1 NM_006758.2  
GGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGG
HKR362155 RBd05G11 pGCAP10 NM_006758.2  
GGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAAT
HKR369255 RBd23C07 pGCAP10 NM_006758.2  
GAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTT
HKR373605 RBd34A05 pGCAP10 NM_006758.2  
GGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGT
HKR375775 RBd39H07 pGCAP10 NM_006758.2  
GGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGG
HKR376073 RBd40D01 pGCAP10 NM_006758.2  
GAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTT
HKR381771 RBd54H03 pGCAP10 NM_006758.2  
GAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCNTCTTCGGCACCGAGAA
HKR386150 RBd65G06 pGCAP10 NM_006758.2  
GGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGA
HKR388531 RBd71F11 pGCAP10 NM_006758.2  
GAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTT
HKR432783 RBdS081P23 pGCAP10 NM_006758.2  
GCTCCGGAGCCGCCGCCTCGTGGGCCGCGCGGCGGAAAACTGGAGCGGGCAGAATGAATG
HKR444377 RBdS110P17 pGCAP10 NM_006758.2  
GGTCTCCCGAGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCG
HKR474934 RBdS187F14 pGCAP10 NM_006758.2  
TGGACGTCTCCCGCGGGCGTCGGCAGGGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl