Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04557

HP ID(1) HP04557
Gene ID(2) 8625
Gene Symbol finder RFXANK
Protein Name regulatory factor X-associated ankyrin-containing protein
RefSeq NM_003721.2
Length of RefSeq (bp) 1438
Chromosome 19p12
Reference DDBJ accession
UniGene Hs.296776

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa54G02 pKA1U5 GAGAGGCAGCACTTACTGCCCGGGCCCTTCCTCACTTTTGGGGGGCGGGGGTGCGCAAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl