Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04553

HP ID(1) HP04553
Gene ID(2) 3275
Gene Symbol finder PRMT2
Protein Name protein arginine methyltransferase 2
RefSeq NM_001535.2
Length of RefSeq (bp) 2140
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.154163

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe78F12 pKA1U5 GGTCCACCCCTCCGCGCTGGCGGTGTGGACGCGGAACTCAGCGGAGAAACGCGATTGAGA
ARiS194B06 pGCAP10 GGAGGGCGGTGGCTCAGGCTCCTGGAAAGGACCGTCCACCCCTCCGCGCTGGCGGTGTGG
ARiS194E10 pGCAP10 GCTTCCCGGCTGACGGCCTGCGTGCACTGCGCTTGCGCGGGTTGAGGGCGGTGGCTCAGG
RBb12C10 pKA1U5 GGAGGGCGGTGGCTCAGTCTCCTGGAAAGGACCGCTCCACCCCTCCGCGCTGGCGGTGTG
RBb18G11 pKA1U5 GGCGGGTTGAGGGCGGTGGCTCAGGCTCCTGGAAAGGACCGTCCACCCCTCCGCGCTGGC
RBd20G12 pGCAP10 GGCCGGGCCCTGGGCGGGGCCTTCCCGGCTGACGGCCTGCGTGCACTGCGCTTGCGCGGG
RBd93B08 pGCAP10 GGAGGGCGGTGGCTCAGGCTCCTGGAAAGGACCGTCCACCCCTCCGCGCTGGCGGTGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl