Prev. |  KEGG KO K11435 > 

RIKEN DNA Bank Human Resource - PRMT2

Gene ID NCBI Gene 3275 |  KEGG hsa:3275
Gene Symbol PRMT2
Protein Name protein arginine methyltransferase 2
Synonyms HRMT1L1
Ortholog resources KEGG ortholog (KEGG orthology K11435) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082898 IRAL007E02 pOTB7 BC000727 NM_206962 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071332 ARe78F12 pKA1U5 NM_001535.2  
GGTCCACCCCTCCGCGCTGGCGGTGTGGACGCGGAACTCAGCGGAGAAACGCGATTGAGA
HKR277630 ARiS194B06 pGCAP10 NM_001535.2  
GGAGGGCGGTGGCTCAGGCTCCTGGAAAGGACCGTCCACCCCTCCGCGCTGGCGGTGTGG
HKR277706 ARiS194E10 pGCAP10 NM_001535.2  
GCTTCCCGGCTGACGGCCTGCGTGCACTGCGCTTGCGCGGGTTGAGGGCGGTGGCTCAGG
HKR324858 RBb12C10 pKA1U5 NM_001535.2  
GGAGGGCGGTGGCTCAGTCTCCTGGAAAGGACCGCTCCACCCCTCCGCGCTGGCGGTGTG
HKR327355 RBb18G11 pKA1U5 NM_001535.2  
GGCGGGTTGAGGGCGGTGGCTCAGGCTCCTGGAAAGGACCGTCCACCCCTCCGCGCTGGC
HKR368156 RBd20G12 pGCAP10 NM_001535.2  
GGCCGGGCCCTGGGCGGGGCCTTCCCGGCTGACGGCCTGCGTGCACTGCGCTTGCGCGGG
HKR397232 RBd93B08 pGCAP10 NM_001535.2  
GGAGGGCGGTGGCTCAGGCTCCTGGAAAGGACCGTCCACCCCTCCGCGCTGGCGGTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl