Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04550

HP ID(1) HP04550
Gene ID(2) 84955
Gene Symbol finder NUDCD1
Protein Name NudC domain containing 1
RefSeq NM_032869.3
Length of RefSeq (bp) 3965
Chromosome 8q23
Reference DDBJ accession
UniGene Hs.380291

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe73E06 pKA1U5 GCCCAGTCTCTGTGCGAGGCGTGAAGCGCGGACCTTTCAACAAGGGCTTTATTAATTCTC
ARi31A06 pGCAP10 GAGTGTTTTCTGGGATGGGAACCACGCCGCTTCCCAGTCTCTGTGCGAGGCGTGAAGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl