Prev. | 

RIKEN DNA Bank Human Resource - NUDCD1

Gene ID NCBI Gene 84955 |  KEGG hsa:84955
Gene Symbol NUDCD1
Protein Name NudC domain containing 1
Synonyms CML66|OVA66
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001422 IRAK003J06 pCMV-SPORT6 BC000967 NM_032869 Full/var
HGX035922 IRAK089N10 pCMV-SPORT6 BC043406 NM_032869

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069302 ARe73E06 pKA1U5 NM_032869.3  
GCCCAGTCTCTGTGCGAGGCGTGAAGCGCGGACCTTTCAACAAGGGCTTTATTAATTCTC
HKR172406 ARi31A06 pGCAP10 NM_032869.3  
GAGTGTTTTCTGGGATGGGAACCACGCCGCTTCCCAGTCTCTGTGCGAGGCGTGAAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl