Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04545

HP ID(1) HP04545
Gene ID(2) 94005
Gene Symbol finder PIGS
Protein Name phosphatidylinositol glycan anchor biosynthesis, class S
RefSeq NM_033198.3
Length of RefSeq (bp) 2873
Chromosome 17p13.2
Reference DDBJ accession
UniGene Hs.462550

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45G05 pGCAP10 GCTGCCCCCACGGTGGCCGGAGCAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGC
ARi70H02 pGCAP10 AGGGCCGGAGCAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGCTACACACCTAGA
RBb19A05 pKA1U5 ATCCTGGAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGCTACACACCTAGGTGCG
RBb50C09 pGCAP1 GCCCACGGTGGCCGGAGCAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGCTACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl