Prev. |  KEGG KO K05291 > 

RIKEN DNA Bank Human Resource - PIGS

Gene ID NCBI Gene 94005 |  KEGG hsa:94005
Gene Symbol PIGS
Protein Name phosphatidylinositol glycan anchor biosynthesis class S
Synonyms GPIBD18
Ortholog resource in our bank

  PIGS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001923 IRAK004N11 pCMV-SPORT6 BC001319 NM_033198 Partial
HGY101639 IRAL054B15 pOTB7 BC069228 NM_033198 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178149 ARi45G05 pGCAP10 NM_033198.3  
GCTGCCCCCACGGTGGCCGGAGCAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGC
HKR188170 ARi70H02 pGCAP10 NM_033198.3  
AGGGCCGGAGCAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGCTACACACCTAGA
HKR327605 RBb19A05 pKA1U5 NM_033198.3  
ATCCTGGAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGCTACACACCTAGGTGCG
HKR340057 RBb50C09 pGCAP1 NM_033198.3  
GCCCACGGTGGCCGGAGCAGCCGGAAGCTAGCATGGCGGCCGCCGGGGCTGCGGCTACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl