Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04523

HP ID(1) HP04523
Gene ID(2) 784
Gene Symbol finder CACNB3
Protein Name calcium channel, voltage-dependent, beta 3 subunit
RefSeq NM_000725.2
Length of RefSeq (bp) 2714
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.250712

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096N04 pGCAP10 GGCGGGGCTCGGTGGCATCTCCCGGGCGCGGCCCGCAGTCCTTGCCCCTGCCTCCGGGCC
RBd82G05 pGCAP10 AGCCTTCCTCCCCGCCGCCACGGCCCCGTAGGTGCTCGGGGACCCACCTTCCACCTAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl