Prev. |  KEGG KO K04864 > 

RIKEN DNA Bank Human Resource - CACNB3

Gene ID NCBI Gene 784 |  KEGG hsa:784
Gene Symbol CACNB3
Protein Name calcium voltage-gated channel auxiliary subunit beta 3
Synonyms CAB3|CACNLB3
Ortholog resource in our bank

  CACNB3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY031161 IRAK077P01 pBluescriptR BC041811 NM_000725 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238716 ARiS096N04 pGCAP10 NM_000725.2  
GGCGGGGCTCGGTGGCATCTCCCGGGCGCGGCCCGCAGTCCTTGCCCCTGCCTCCGGGCC
HKR392949 RBd82G05 pGCAP10 NM_000725.2  
AGCCTTCCTCCCCGCCGCCACGGCCCCGTAGGTGCTCGGGGACCCACCTTCCACCTAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl