Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04503

HP ID(1) HP04503
Gene ID(2) 91419
Gene Symbol finder XRCC6BP1
Protein Name XRCC6 binding protein 1
RefSeq NM_033276.2
Length of RefSeq (bp) 1182
Chromosome 12q14.1
Reference DDBJ accession
UniGene Hs.61188

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09D10 pKA1U5 GCCCGCCTCCCGCGCTCCCCGTCAGGTTCAAAGCCCCCATCCCGCCTAACGTCTTCAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl