Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04497

HP ID(1) HP04497
Gene ID(2) 11342
Gene Symbol finder RNF13
Protein Name ring finger protein 13
RefSeq NM_007282.4
Length of RefSeq (bp) 2965
Chromosome 3q25.1
Reference DDBJ accession
UniGene Hs.12333

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe63H05 pKA1U5 GGGTCGGTGCGGATATTCAGTCATGAAATCAGGNCTANGGACTTCTCCCGCAGCGACGCG
ARi43A07 pGCAP10 GAGGGAAGAGACGCGTCAGCGCCAGGGCCAGGCCCGCCCGGGGGCAGCCCGGCAGCCGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl