Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04496

HP ID(1) HP04496
Gene ID(2) 26121
Gene Symbol finder PRPF31
Protein Name PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)
RefSeq NM_015629.3
Length of RefSeq (bp) 2201
Chromosome 19q13.42
Reference DDBJ accession
UniGene Hs.515598

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13A01 pKA1U5 GAGTGGTGCGCGGAGAGGAGAGGCCTCGGGATGTCTCTGGCAGATGAGCTCTTAGCTGAT
ARe67A12 pKA1U5 AB593025 GGGTGAGCGACTAACGCTAGAAACAGTGGTGCGCGGAGAGGAGAGGCCTCGGGATGTCTC
ARiS194J17 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl