Prev. |  KEGG KO K12844 > 

RIKEN DNA Bank Human Resource - PRPF31

Gene ID NCBI Gene 26121 |  KEGG hsa:26121
Gene Symbol PRPF31
Protein Name pre-mRNA processing factor 31
Synonyms NY-BR-99|PRP31|RP11|SNRNP61
Ortholog resources KEGG ortholog (KEGG orthology K12844) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014725 W01A036N13 pENTR-TOPO flj0061l22 AK098547 NM_015629  
HGE014727 W01A036N15 pENTR-TOPO flj0061l22 AK098547 NM_015629  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045201 ARe13A01 pKA1U5 NM_015629.3  
GAGTGGTGCGCGGAGAGGAGAGGCCTCGGGATGTCTCTGGCAGATGAGCTCTTAGCTGAT
HKR066812 ARe67A12 pKA1U5 NM_015629.3  
GGGTGAGCGACTAACGCTAGAAACAGTGGTGCGCGGAGAGGAGAGGCCTCGGGATGTCTC
HKR277833 ARiS194J17 pGCAP10 NM_015629.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl