Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04492

HP ID(1) HP04492
Gene ID(2) 10197
Gene Symbol finder PSME3
Protein Name proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
RefSeq NM_005789.2
Length of RefSeq (bp) 3189
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.152978

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15A06 pKA1U5 GAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGAGCGAGCAGTGAGT
ARi31A12 pGCAP10 GAATCCGGGAGGGCGAGCGAGAGAGCAGGCAGGCAACATGCTGCCGGCGGGCGGGCGGAC
ARi42F02 pGCAP10 GGAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGG
ARiS085L01 pGCAP10 GAGAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACA
ARiS085M08 pGCAP10 GGGACACGGCCCGGCCCGGCCATGGCCTCGTTGCTGAAGGTGGATCAGGAAGTGAAGCTC
ARiS150C08 pGCAP10 GAGGCAGCAGGCTGCCNNCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGAGCGAGCAGT
RBb07B06 pKA1U5 GACAGAGGGAGGGAGCGAGCGAGCAGTGAGTAAGCCAGCAAGGGCGGTCGGGTCCCGAGG
RBb17F01 pKA1U5 GGCGAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGC
RBb61E12 pGCAP1 GAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGAGCGAGCAGTGAGTAAG
RBb67A08 pGCAP1 GAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGA
RBd05B11 pGCAP10 GAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGA
RBd38H05 pGCAP10 TGAGTTTCCGGCGTGAGCGGCGAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGGCAGCA
RBd55C09 pGCAP10 GAGTTTCCGGCGTGAGCGGCGAAAGCCGGGAGGGCGAGCGANNNNNCAAGCAGGCAGCAG
RBdS187M07 pGCAP10 GAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl