Prev. |  KEGG KO K06698 > 

RIKEN DNA Bank Human Resource - PSME3

Gene ID NCBI Gene 10197 |  KEGG hsa:10197
Gene Symbol PSME3
Protein Name proteasome activator subunit 3
Synonyms HEL-S-283|Ki|PA28-gamma|PA28G|PA28gamma|REG-GAMMA
Ortholog resources KEGG ortholog (KEGG orthology K06698) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081896 IRAL004M08 pOTB7 BC001423 NM_005789 Full
HGY085093 IRAL012M05 pOTB7 BC002684 NM_005789 Full
HGY089448 IRAL023K08 pOTB7 BC008020 NM_005789 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046006 ARe15A06 pKA1U5 NM_005789.2  
GAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGAGCGAGCAGTGAGT
HKR172412 ARi31A12 pGCAP10 NM_005789.2  
GAATCCGGGAGGGCGAGCGAGAGAGCAGGCAGGCAACATGCTGCCGGCGGGCGGGCGGAC
HKR176922 ARi42F02 pGCAP10 NM_005789.2  
GGAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGG
HKR234265 ARiS085L01 pGCAP10 NM_005789.2  
GAGAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACA
HKR234296 ARiS085M08 pGCAP10 NM_005789.2  
GGGACACGGCCCGGCCCGGCCATGGCCTCGTTGCTGAAGGTGGATCAGGAAGTGAAGCTC
HKR260056 ARiS150C08 pGCAP10 NM_005789.2  
GAGGCAGCAGGCTGCCNNCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGAGCGAGCAGT
HKR322830 RBb07B06 pKA1U5 NM_005789.2  
GACAGAGGGAGGGAGCGAGCGAGCAGTGAGTAAGCCAGCAAGGGCGGTCGGGTCCCGAGG
HKR326921 RBb17F01 pKA1U5 NM_005789.2  
GGCGAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGC
HKR344508 RBb61E12 pGCAP1 NM_005789.2  
GAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGAGCGAGCAGTGAGTAAG
HKR346808 RBb67A08 pGCAP1 NM_005789.2  
GAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGA
HKR362035 RBd05B11 pGCAP10 NM_005789.2  
GAGGGCGAGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGA
HKR375373 RBd38H05 pGCAP10 NM_005789.2  
TGAGTTTCCGGCGTGAGCGGCGAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGGCAGCA
HKR382057 RBd55C09 pGCAP10 NM_005789.2  
GAGTTTCCGGCGTGAGCGGCGAAAGCCGGGAGGGCGAGCGANNNNNCAAGCAGGCAGCAG
HKR475095 RBdS187M07 pGCAP10 NM_005789.2  
GAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGGAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl