Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04477

HP ID(1) HP04477
Gene ID(2) 29071
Gene Symbol finder C1GALT1C1
Protein Name C1GALT1-specific chaperone 1
RefSeq NM_152692.3
Length of RefSeq (bp) 1838
Chromosome Xq24
Reference DDBJ accession
UniGene Hs.643920

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe64H05 pKA1U5 ATCCTGACCAACGAGAGAACACCGCCTGCAGCTAGAACAGCCTGGNTCAGGAGCGTAACG
ARiS150D23 pGCAP10 GGTAACGGAGTGGTGCGCCAACGTGAGAGGAAACCCGTGCGCGGCTGCGCTTTCCTGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl