Prev. |  KEGG KO K09653 > 

RIKEN DNA Bank Human Resource - C1GALT1C1

Gene ID NCBI Gene 29071 |  KEGG hsa:29071
Gene Symbol C1GALT1C1
Protein Name C1GALT1 specific chaperone 1
Synonyms C1GALT2|C38H2-L1|COSMC|HSPC067|MST143|TNPS
Ortholog resource in our bank

  C1GALT1C1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011276 IRAK028D04 pCMV-SPORT6 BC012502 NM_152692 Partial/var
HGX039237 IRAK098B13 pCMV-SPORT6 BC050441 NM_152692 Full
HGY091245 IRAL028B21 pOTB7 BC011930 NM_152692 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065773 ARe64H05 pKA1U5 NM_152692.3  
ATCCTGACCAACGAGAGAACACCGCCTGCAGCTAGAACAGCCTGGNTCAGGAGCGTAACG
HKR260095 ARiS150D23 pGCAP10 NM_152692.3  
GGTAACGGAGTGGTGCGCCAACGTGAGAGGAAACCCGTGCGCGGCTGCGCTTTCCTGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl