Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04462

HP ID(1) HP04462
Gene ID(2) 283869
Gene Symbol finder NPW
Protein Name neuropeptide W
RefSeq NM_001099456.2
Length of RefSeq (bp) 1033
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.233533

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191N01 pGCAP10 GGGCTCGCCTCCAGCCTCCTGCGCTCCGGTACCTGGGCGTCCCAACTCCACTGCGCGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl