Prev. | 

RIKEN DNA Bank Human Resource - NPW

Gene ID NCBI Gene 283869 |  KEGG hsa:283869
Gene Symbol NPW
Protein Name neuropeptide W
Synonyms L8|L8C|PPL8|PPNPW
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276713 ARiS191N01 pGCAP10 NM_001099456.2  
GGGCTCGCCTCCAGCCTCCTGCGCTCCGGTACCTGGGCGTCCCAACTCCACTGCGCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl