Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPW

Gene ID (NCBI) 283869
Gene Symbol NPW
Protein Name neuropeptide W
Synonyms L8|L8C|PPL8|PPNPW
Databases KEGG hsa:283869 |  NCBI Gene 283869


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276713 ARiS191N01 pGCAP10 NM_001099456.2  
GGGCTCGCCTCCAGCCTCCTGCGCTCCGGTACCTGGGCGTCCCAACTCCACTGCGCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl