Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04459

HP ID(1) HP04459
Gene ID(2) 6001
Gene Symbol finder RGS10
Protein Name regulator of G-protein signalling 10
RefSeq NM_002925.3
Length of RefSeq (bp) 859
Chromosome 10q25
Reference DDBJ accession
UniGene Hs.501200

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe69G11 pKA1U5 ATCCTGGCTCCTCCTCGCCTTCCTCCGGCTCAGCCGCCGCGCCGCCGGGCTGCTCCTTCT
ARi41G02 pGCAP10 GCTCGCCTTCCTCCGGCTCAGCCGCCGCGCCGCCGGGCTGCTCCTTCTTCCTCCTCGGGC
ARiS023K12 pGCAP10 GTTCCTCCGGCTCAGCCGCCGCGCCGCCGGGCTGCTCCTTCTTCCTCCTCGGGCGCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl