Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04451

HP ID(1) HP04451
Gene ID(2) 26472
Gene Symbol finder PPP1R14B
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 14B
RefSeq NM_138689.2
Length of RefSeq (bp) 1038
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.523760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06D12 pKA1U5 GGCCGCCGCCGCCCTCGCCGCGGTAGCCGCGCGNCAGCGGAGCCGGCGAGCTAACCCGGG
ARe08B11 pKA1U5 GAGAGCGAGACAGAGAAAGCGCTTCGGCGGCTGCAGCTCGGGCGGCGGCCGCGGGGGACA
ARe11C10 pKA1U5 GGGCCGCGGGGGACAAAGGGCGGGCGGATCGGCGGGGTAGGGGGCGGGGCGCGGCCAGNC
ARe49H12 pKA1U5 GAGGCCAAGCCCGGGGGCTCCGCATGCTGCANCCTGTTNNCGGGCGCCCCCGCCGCCGCC
ARe82A06 pKA1U5 GGCCATGGCGGACAGCGGCACCGCGGGGGGCGCGGCGTTGGCGGCCCCGGCCCCCGGGCC
ARe94C05 pKA1U5 GCCAAGCCCGGGGGCTCCGCATGCTGCAGCTGCCCCCGGGCGCCCCCGCCGCCGCCCTCG
ARi09C02 pGCAP10 GCCCCAGAGCAGCTGCTGTTCTGTCTGCTGGGCAGAGGGCTGGGTTCCTCCGAGGAAGAG
ARi22B01 pGCAP10 GGCAGCTCGGGCGGCGGCCGCGGGGGACAAAGGGCGGGCGGNNCGGTGGGGAGGGGGCGG
ARiS049H16 pGCAP10 TCCCCCGCCGCCGCCCTCGCCGCGGAGCCGCGCGGAGCGGAGCCGGCGAGCTAACCCGAG
ARiS109I14 pGCAP10 GGCaGCTGCCCCCGGGCGCCCCCGCCGCCGCCCTCGCCGC
ARiS118B06 pGCAP10 GGTTTCCTCTTTGCCAGGCCTGGGTCCTTCCCAGTGACCCCTCAGCCTTCACTTCCTCCT
ARiS118E24 pGCAP10 GATGCTGCAGCTGCCCCCGGGCGCCCCCGCCGCCGCCCTCGCCGCGGAGCCGCGCGGAGC
RBb06E12 pKA1U5 GGCTCGCACGTGGCCCCGGCGGCCGCCATGGCGGACAGCGGCACCGCGGGGGGCGCGGCG
RBb17B11 pKA1U5 GCCGGGCGGGGCGGACGATGAGGGCCCAGTGAGGCGCCAAGGGAAGGTCACCGTCAAGTA
RBd22C08 pGCAP10 GGCCATGGCGGACAGCGGCACCGCGGGGGGCGCGGCGTTGGCGGCCCCGGCCCCCGGGCC
RBd95C10 pGCAP10 GCAGGCCAAGCCCGGGGGCTCCGCATGCTGCAGCTGCCCCCGGGCGCCCCCGCCGCCGCC
RBdS187F22 pGCAP10 GGGGCGGGGCGCGGCCAGGCCAAGCCCGGGGGCTCCGCATGCTGCAGCTGCCCCCGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl