Prev. |  KEGG KO K17555 > 

RIKEN DNA Bank Human Resource - PPP1R14B

Gene ID NCBI Gene 26472 |  KEGG hsa:26472
Gene Symbol PPP1R14B
Protein Name protein phosphatase 1 regulatory inhibitor subunit 14B
Synonyms PHI-1|PLCB3N|PNG|SOM172
Ortholog resources KEGG ortholog (KEGG orthology K17555) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085775 IRAL014H07 pOTB7 BC014522 NM_138689 Full
HGY103352 IRAL058G08 pOTB7 BC071884 NM_138689 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042484 ARe06D12 pKA1U5 NM_138689.2  
GGCCGCCGCCGCCCTCGCCGCGGTAGCCGCGCGNCAGCGGAGCCGGCGAGCTAACCCGGG
HKR043235 ARe08B11 pKA1U5 NM_138689.2  
GAGAGCGAGACAGAGAAAGCGCTTCGGCGGCTGCAGCTCGGGCGGCGGCCGCGGGGGACA
HKR044458 ARe11C10 pKA1U5 NM_138689.2  
GGGCCGCGGGGGACAAAGGGCGGGCGGATCGGCGGGGTAGGGGGCGGGGCGCGGCCAGNC
HKR059780 ARe49H12 pKA1U5 NM_138689.2  
GAGGCCAAGCCCGGGGGCTCCGCATGCTGCANCCTGTTNNCGGGCGCCCCCGCCGCCGCC
HKR072806 ARe82A06 pKA1U5 NM_138689.2  
GGCCATGGCGGACAGCGGCACCGCGGGGGGCGCGGCGTTGGCGGCCCCGGCCCCCGGGCC
HKR077653 ARe94C05 pKA1U5 NM_138689.2  
GCCAAGCCCGGGGGCTCCGCATGCTGCAGCTGCCCCCGGGCGCCCCCGCCGCCGCCCTCG
HKR163650 ARi09C02 pGCAP10 NM_138689.2  
GCCCCAGAGCAGCTGCTGTTCTGTCTGCTGGGCAGAGGGCTGGGTTCCTCCGAGGAAGAG
HKR168825 ARi22B01 pGCAP10 NM_138689.2  
GGCAGCTCGGGCGGCGGCCGCGGGGGACAAAGGGCGGGCGGNNCGGTGGGGAGGGGGCGG
HKR219784 ARiS049H16 pGCAP10 NM_138689.2  
TCCCCCGCCGCCGCCCTCGCCGCGGAGCCGCGCGGAGCGGAGCCGGCGAGCTAACCCGAG
HKR243806 ARiS109I14 pGCAP10 NM_138689.2  
GGCaGCTGCCCCCGGGCGCCCCCGCCGCCGCCCTCGCCGC
HKR247230 ARiS118B06 pGCAP10 NM_138689.2  
GGTTTCCTCTTTGCCAGGCCTGGGTCCTTCCCAGTGACCCCTCAGCCTTCACTTCCTCCT
HKR247320 ARiS118E24 pGCAP10 NM_138689.2  
GATGCTGCAGCTGCCCCCGGGCGCCCCCGCCGCCGCCCTCGCCGCGGAGCCGCGCGGAGC
HKR322508 RBb06E12 pKA1U5 NM_138689.2  
GGCTCGCACGTGGCCCCGGCGGCCGCCATGGCGGACAGCGGCACCGCGGGGGGCGCGGCG
HKR326835 RBb17B11 pKA1U5 NM_138689.2  
GCCGGGCGGGGCGGACGATGAGGGCCCAGTGAGGCGCCAAGGGAAGGTCACCGTCAAGTA
HKR368856 RBd22C08 pGCAP10 NM_138689.2  
GGCCATGGCGGACAGCGGCACCGCGGGGGGCGCGGCGTTGGCGGCCCCGGCCCCCGGGCC
HKR398058 RBd95C10 pGCAP10 NM_138689.2  
GCAGGCCAAGCCCGGGGGCTCCGCATGCTGCAGCTGCCCCCGGGCGCCCCCGCCGCCGCC
HKR474942 RBdS187F22 pGCAP10 NM_138689.2  
GGGGCGGGGCGCGGCCAGGCCAAGCCCGGGGGCTCCGCATGCTGCAGCTGCCCCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl