Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04445

HP ID(1) HP04445
Gene ID(2) 11156
Gene Symbol finder PTP4A3
Protein Name protein tyrosine phosphatase type IVA, member 3
RefSeq NM_032611.1
Length of RefSeq (bp) 1396
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.43666

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa41D04 pKA1U5 ATCCTGTTTTTTTTAATTATCCAAACAGTGGGCAGCTTCCTCCCCCACACCCAAGTATTT
RBd44D06 pGCAP10 GGCGCGCGTCCCGAGCCCTCCACCCGTCGTGCCGGCGCCGCCCGGACCGCCAGATGCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl