Prev. |  KEGG KO K18041 > 

RIKEN DNA Bank Human Resource - PTP4A3

Gene ID NCBI Gene 11156 |  KEGG hsa:11156
Gene Symbol PTP4A3
Protein Name protein tyrosine phosphatase type IVA, member 3
Synonyms PRL-3|PRL-R|PRL3
Ortholog resources KEGG ortholog (KEGG orthology K18041) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082414 IRAL006A14 pOTB7 BC003105 NM_007079 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024649 W01A061K09 pENTR-TOPO IRAL006A14 BC003105 NM_007079  
HGE024651 W01A061K11 pENTR-TOPO IRAL006A14 BC003105 NM_007079  
HGE024653 W01A061K13 pENTR-TOPO IRAL006A14 BC003105 NM_007079  
HGE024655 W01A061K15 pENTR-TOPO IRAL006A14 BC003105 NM_007079  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR016476 ARa41D04 pKA1U5 NM_032611.1  
ATCCTGTTTTTTTTAATTATCCAAACAGTGGGCAGCTTCCTCCCCCACACCCAAGTATTT
HKR377678 RBd44D06 pGCAP10 NM_032611.1  
GGCGCGCGTCCCGAGCCCTCCACCCGTCGTGCCGGCGCCGCCCGGACCGCCAGATGCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl