Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04442

HP ID(1) HP04442
Gene ID(2) 83636
Gene Symbol finder C19orf12
Protein Name chromosome 19 open reading frame 12
RefSeq NM_031448.3
Length of RefSeq (bp) 4702
Chromosome 19q12
Reference DDBJ accession
UniGene Hs.529094

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe27C05 pKA1U5 GGCCGCCACCAAGGCCTGCGCGACCCTCCGCGGGGCTGGGGAGCTGGGCGGGGAGCCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl