Prev. | 

RIKEN DNA Bank Human Resource - C19orf12

Gene ID NCBI Gene 83636 |  KEGG hsa:83636
Gene Symbol C19orf12
Protein Name chromosome 19 open reading frame 12
Synonyms MPAN|NBIA3|NBIA4|SPG43
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053703 IRAK134E07 pCMV-SPORT6 BC063518 NM_031448 Full/var
HGY085212 IRAL013A12 pOTB7 BC004957 NM_031448 Full
HGY088120 IRAL020E24 pOTB7 BC009946 NM_031448 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050853 ARe27C05 pKA1U5 NM_031448.3  
GGCCGCCACCAAGGCCTGCGCGACCCTCCGCGGGGCTGGGGAGCTGGGCGGGGAGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl